Homologi Gen Seleno Metiltransferase (smt) pada Geobacillus sp. 20k dengan smt Astragalus bisulcatus
Abstract
Metil selenosistein (MSC) merupakan bentuk selenium yang paling efektif melawan sel kanker. Pembentukan MSC diperantarai oleh enzim seleno metiltransferase (disandi gen smt) sebagai mekanisme detoksifikasi selenium dengan cara metilasi selenosistein. Gen smt telahdikarakterisasi dari tumbuhan yang kaya selenium, Astragalus bisulcatus. Dilakukan penelitian eksperimental laboratorik terhadap Geobacillus sp. 20k di Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, periode November 2008–Juni 2009. Gen smt dideteksi dengan polymerase chain reaction dan sekuensing. Sekuens fragmen DNA dianalisis menggunakan program basic local alignment search tool (BLAST). Hasil pencarian homologi menunjukkan gen smt dan homolognya pada umumnya terdapat pada tumbuhan pengakumulasi selenium, antara lain A. bisulcatus, C. sinensis, dan A. thaliana dengan kesamaan >85%. Primer yang didesain untuk amplifikasi smt adalah CAAGCCACCATTCAAGGTTT dan CCCTACTGATCCCGC AATTA. Hasil amplifikasi fragmen DNA didapatkan sekitar 190 base pair. Sekuens DNA dan translasi proteinnya teridentifikasi sebagai bagian dari enzim termofilik dan smt A. bisulcatus, dengan tingkat kesamaan 83% untuk gen smt dan 88–90% untuk proteinnya. Disimpulkan Geobacillus sp. 20k memiliki gen serupa dengan gen smt A. bisulcatus sehingga pengembangan lebih lanjut sebagai sumber selenium nontoksik untuk terapi kanker perlu dipertimbangkan. [MKB. 2010;42(3):128-34].
Kata kunci: kanker, selenium nontoksik, seleno metiltransferase
Homology of Seleno Methyltransferase (smt) Gene from Geobacillus sp. 20k with That from Astragalus bisulcatus
Methylselenocysteine (MSC) is the most effective form of selenium against cancer. The synthesis of MSC is catalyzed by seleno methyltransferase (smt) through selenium methylation as its detoxification mechanism. Gene of smt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study was done on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, November 2008–June 2009.Target gene was detected by polymerase chain reaction and sequencing. DNA sequence was analyzed by the basic local alignment search tool (BLAST). The results showed that smt gene and its homolog were generally found on selenium rich plants, such as A. bisulcatus, C. sinensis, and A. thaliana, with similarity more than 85%. Designed primers for amplification of smt are CAAGCCACCATTCAAGGTTT and CCCTACTGATCCCGCAATTA. Amplification of DNA fragments obtained at approximately 190 base pair. DNA sequence and its protein translation were identified as part of the thermophilic enzyme and smt of A. bisulcatus, with 83% similarity for smt genes and 88–90% for protein. In conclusion, Geobacillus sp. 20k have smt genes similar with that of A. bisulcatus, therefore further development of this isolate as a non toxic selenium source for cancer therapy could be taken into consideration. [MKB. 2010;42(3):128-34].
Key words: Cancer, Geobacillus sp. 20k, non toxic selenium, methyl selenocystein, seleno methyltransferase
Full Text:
PDFArticle Metrics
Abstract view : 786 timesPDF - 400 times

MKB is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License
View My Stats





